remap

 

Function

Display a sequence with restriction cut sites, translation etc

Description

The Restriction Enzyme database (REBASE) is a collection of information about restriction enzymes and related proteins. It contains published and unpublished references, recognition and cleavage sites, isoschizomers, commercial availability, methylation sensitivity, crystal and sequence data. DNA methyltransferases, homing endonucleases, nicking enzymes, specificity subunits and control proteins are also included. Most recently, putative DNA methyltransferases and restriction enzymes, as predicted from analysis of genomic sequences, are also listed.

The home page of REBASE is: http://rebase.neb.com/

This program uses REBASE data to find the recognition sites and/or cut sites of restriction enzymes in a nucleic acid sequence.

This program displays the cut sites on both strands by default. It will optionally also display the translation of the sequence.

There are many options to change the style of display to aid in making clear presentations.

One potentially very useful option is '-flatreformat' that displays not only the cut sites which many other restriction cut-site programs will show, but also shows the recognition site.

Usage

Here is a sample session with remap

This example uses only a small region of the input sequence to save space.


% remap -notran -sbeg 1 -send 60 
Display a sequence with restriction cut sites, translation etc..
Input sequence(s): tembl:eclac
Comma separated enzyme list [all]: taqi,bsu6i,acii,bsski
Minimum recognition site length [4]: 
Output file [eclac.remap]: 

Go to the input files for this example
Go to the output files for this example

Example 2

This is an example where all enzymes in the REBASE database are used:


% remap -notran -sbeg 1 -send 60 
Display a sequence with restriction cut sites, translation etc..
Input sequence(s): tembl:eclac
Comma separated enzyme list [all]: 
Minimum recognition site length [4]: 
Output file [eclac.remap]: 

Go to the output files for this example

Example 3

This shows the 'flat' format:


% remap -notran -sbeg 1 -send 60 -flat 
Display a sequence with restriction cut sites, translation etc..
Input sequence(s): tembl:eclac
Comma separated enzyme list [all]: 
Minimum recognition site length [4]: 
Output file [eclac.remap]: 

Go to the output files for this example

Command line arguments

   Mandatory qualifiers:
  [-sequence]          seqall     Sequence database USA
   -enzymes            string     The name 'all' reads in all enzyme names
                                  from the REBASE database. You can specify
                                  enzymes by giving their names with commas
                                  between then, such as:
                                  'HincII,hinfI,ppiI,hindiii'.
                                  The case of the names is not important. You
                                  can specify a file of enzyme names to read
                                  in by giving the name of the file holding
                                  the enzyme names with a '@' character in
                                  front of it, for example, '@enz.list'.
                                  Blank lines and lines starting with a hash
                                  character or '!' are ignored and all other
                                  lines are concatenated together with a comma
                                  character ',' and then treated as the list
                                  of enzymes to search for.
                                  An example of a file of enzyme names is:
                                  ! my enzymes
                                  HincII, ppiII
                                  ! other enzymes
                                  hindiii
                                  HinfI
                                  PpiI
   -sitelen            integer    Minimum recognition site length
  [-outfile]           outfile    If you enter the name of a file here then
                                  this program will write the sequence details
                                  into that file.

   Optional qualifiers:
   -mincuts            integer    Minimum cuts per RE
   -maxcuts            integer    Maximum cuts per RE
   -single             boolean    Force single site only cuts
   -[no]blunt          boolean    Allow blunt end cutters
   -[no]sticky         boolean    Allow sticky end cutters
   -[no]ambiguity      boolean    Allow ambiguous matches
   -plasmid            boolean    Allow circular DNA
   -[no]commercial     boolean    Only enzymes with suppliers
   -table              menu       Code to use
   -[no]cutlist        boolean    List the enzymes that cut
   -flatreformat       boolean    Display RE sites in flat format
   -[no]limit          boolean    Limits reports to one isoschizomer
   -preferred          boolean    Report preferred isoschizomers

   Advanced qualifiers:
   -[no]translation    boolean    Display translation
   -[no]reverse        boolean    Display cut sites and translation of reverse
                                  sense
   -orfminsize         integer    Minimum size of Open Reading Frames (ORFs)
                                  to display in the translations.
   -uppercase          range      Regions to put in uppercase.
                                  If this is left blank, then the sequence
                                  case is left alone.
                                  A set of regions is specified by a set of
                                  pairs of positions.
                                  The positions are integers.
                                  They are separated by any non-digit,
                                  non-alpha character.
                                  Examples of region specifications are:
                                  24-45, 56-78
                                  1:45, 67=99;765..888
                                  1,5,8,10,23,45,57,99
   -highlight          range      Regions to colour if formatting for HTML.
                                  If this is left blank, then the sequence is
                                  left alone.
                                  A set of regions is specified by a set of
                                  pairs of positions.
                                  The positions are integers.
                                  They are followed by any valid HTML font
                                  colour.
                                  Examples of region specifications are:
                                  24-45 blue 56-78 orange
                                  1-100 green 120-156 red
                                  A file of ranges to colour (one range per
                                  line) can be specifed as '@filename'.
   -threeletter        boolean    Display protein sequences in three-letter
                                  code
   -number             boolean    Number the sequences
   -width              integer    Width of sequence to display
   -length             integer    Line length of page (0 for indefinite)
   -margin             integer    Margin around sequence for numbering
   -[no]name           boolean    Set this to be false if you do not wish to
                                  display the ID name of the sequence
   -[no]description    boolean    Set this to be false if you do not wish to
                                  display the description of the sequence
   -offset             integer    Offset to start numbering the sequence from
   -html               boolean    Use HTML formatting

   General qualifiers:
  -help                boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose


Mandatory qualifiers Allowed values Default
[-sequence]
(Parameter 1)
Sequence database USA Readable sequence(s) Required
-enzymes The name 'all' reads in all enzyme names from the REBASE database. You can specify enzymes by giving their names with commas between then, such as: 'HincII,hinfI,ppiI,hindiii'. The case of the names is not important. You can specify a file of enzyme names to read in by giving the name of the file holding the enzyme names with a '@' character in front of it, for example, '@enz.list'. Blank lines and lines starting with a hash character or '!' are ignored and all other lines are concatenated together with a comma character ',' and then treated as the list of enzymes to search for. An example of a file of enzyme names is: ! my enzymes HincII, ppiII ! other enzymes hindiii HinfI PpiI Any string is accepted all
-sitelen Minimum recognition site length Integer from 2 to 20 4
[-outfile]
(Parameter 2)
If you enter the name of a file here then this program will write the sequence details into that file. Output file <sequence>.remap
Optional qualifiers Allowed values Default
-mincuts Minimum cuts per RE Integer from 1 to 1000 1
-maxcuts Maximum cuts per RE Integer up to 2000000000 2000000000
-single Force single site only cuts Boolean value Yes/No No
-[no]blunt Allow blunt end cutters Boolean value Yes/No Yes
-[no]sticky Allow sticky end cutters Boolean value Yes/No Yes
-[no]ambiguity Allow ambiguous matches Boolean value Yes/No Yes
-plasmid Allow circular DNA Boolean value Yes/No No
-[no]commercial Only enzymes with suppliers Boolean value Yes/No Yes
-table Code to use
0 (Standard)
1 (Standard (with alternative initiation codons))
2 (Vertebrate Mitochondrial)
3 (Yeast Mitochondrial)
4 (Mold, Protozoan, Coelenterate Mitochondrial and Mycoplasma/Spiroplasma)
5 (Invertebrate Mitochondrial)
6 (Ciliate Macronuclear and Dasycladacean)
9 (Echinoderm Mitochondrial)
10 (Euplotid Nuclear)
11 (Bacterial)
12 (Alternative Yeast Nuclear)
13 (Ascidian Mitochondrial)
14 (Flatworm Mitochondrial)
15 (Blepharisma Macronuclear)
16 (Chlorophycean Mitochondrial)
21 (Trematode Mitochondrial)
22 (Scenedesmus obliquus)
23 (Thraustochytrium Mitochondrial)
0
-[no]cutlist List the enzymes that cut Boolean value Yes/No Yes
-flatreformat Display RE sites in flat format Boolean value Yes/No No
-[no]limit Limits reports to one isoschizomer Boolean value Yes/No Yes
-preferred Report preferred isoschizomers Boolean value Yes/No No
Advanced qualifiers Allowed values Default
-[no]translation Display translation Boolean value Yes/No Yes
-[no]reverse Display cut sites and translation of reverse sense Boolean value Yes/No Yes
-orfminsize Minimum size of Open Reading Frames (ORFs) to display in the translations. Integer 0 or more 0
-uppercase Regions to put in uppercase. If this is left blank, then the sequence case is left alone. A set of regions is specified by a set of pairs of positions. The positions are integers. They are separated by any non-digit, non-alpha character. Examples of region specifications are: 24-45, 56-78 1:45, 67=99;765..888 1,5,8,10,23,45,57,99 Sequence range If this is left blank, then the sequence case is left alone.
-highlight Regions to colour if formatting for HTML. If this is left blank, then the sequence is left alone. A set of regions is specified by a set of pairs of positions. The positions are integers. They are followed by any valid HTML font colour. Examples of region specifications are: 24-45 blue 56-78 orange 1-100 green 120-156 red A file of ranges to colour (one range per line) can be specifed as '@filename'. Sequence range full sequence
-threeletter Display protein sequences in three-letter code Boolean value Yes/No No
-number Number the sequences Boolean value Yes/No No
-width Width of sequence to display Integer 1 or more 60
-length Line length of page (0 for indefinite) Integer 0 or more 0
-margin Margin around sequence for numbering Integer 0 or more 10
-[no]name Set this to be false if you do not wish to display the ID name of the sequence Boolean value Yes/No Yes
-[no]description Set this to be false if you do not wish to display the description of the sequence Boolean value Yes/No Yes
-offset Offset to start numbering the sequence from Any integer value 1
-html Use HTML formatting Boolean value Yes/No No

Input file format

Input files for usage example

'tembl:eclac' is a sequence entry in the example nucleic acid database 'tembl'

Database entry: tembl:eclac

ID   ECLAC      standard; DNA; PRO; 7477 BP.
XX
AC   J01636; J01637; K01483; K01793;
XX
SV   J01636.1
XX
DT   30-NOV-1990 (Rel. 26, Created)
DT   04-MAR-2000 (Rel. 63, Last updated, Version 7)
XX
DE   E.coli lactose operon with lacI, lacZ, lacY and lacA genes.
XX
KW   acetyltransferase; beta-D-galactosidase; galactosidase; lac operon;
KW   lac repressor protein; lacA gene; lacI gene; lactose permease; lacY gene;
KW   lacZ gene; mutagenesis; palindrome; promoter region;
KW   thiogalactoside acetyltransferase.
XX
OS   Escherichia coli
OC   Bacteria; Proteobacteria; gamma subdivision; Enterobacteriaceae;
OC   Escherichia.
XX
RN   [1]
RP   1243-1266
RX   MEDLINE; 74055539.
RA   Gilbert W., Maxam A.;
RT   "The nucleotide sequence of the lac operator";
RL   Proc. Natl. Acad. Sci. U.S.A. 70:3581-3584(1973).
XX
RN   [2]
RP   1246-1308
RX   MEDLINE; 74055540.
RA   Maizels N.M.;
RT   "The nucleotide sequence of the lactose messenger ribonucleic acid
RT   transcribed from the UV5 promoter mutant of Escherichia coli";
RL   Proc. Natl. Acad. Sci. U.S.A. 70:3585-3589(1973).
XX
RN   [3]
RX   MEDLINE; 74174501.
RA   Gilbert W., Maizels N., Maxam A.;
RT   "Sequences of controlling regions of the lactose operon";
RL   Cold Spring Harb. Symp. Quant. Biol. 38:845-855(1974).
XX
RN   [4]
RA   Gilbert W., Gralla J., Majors A.J., Maxam A.;
RT   "Lactose operator sequences and the action of lac repressor";
RL   (in) Sund H., Blauer G. (eds.);
RL   PROTEIN-LIGAND INTERACTIONS:193-207;
RL   Walter de Gruyter, New York (1975)
XX
RN   [5]
RP   1146-1282


  [Part of this file has been deleted for brevity]

     cgatttggct acatgacatc aaccatatca gcaaaagtga tacgggtatt atttttgccg      4560
     ctatttctct gttctcgcta ttattccaac cgctgtttgg tctgctttct gacaaactcg      4620
     ggctgcgcaa atacctgctg tggattatta ccggcatgtt agtgatgttt gcgccgttct      4680
     ttatttttat cttcgggcca ctgttacaat acaacatttt agtaggatcg attgttggtg      4740
     gtatttatct aggcttttgt tttaacgccg gtgcgccagc agtagaggca tttattgaga      4800
     aagtcagccg tcgcagtaat ttcgaatttg gtcgcgcgcg gatgtttggc tgtgttggct      4860
     gggcgctgtg tgcctcgatt gtcggcatca tgttcaccat caataatcag tttgttttct      4920
     ggctgggctc tggctgtgca ctcatcctcg ccgttttact ctttttcgcc aaaacggatg      4980
     cgccctcttc tgccacggtt gccaatgcgg taggtgccaa ccattcggca tttagcctta      5040
     agctggcact ggaactgttc agacagccaa aactgtggtt tttgtcactg tatgttattg      5100
     gcgtttcctg cacctacgat gtttttgacc aacagtttgc taatttcttt acttcgttct      5160
     ttgctaccgg tgaacagggt acgcgggtat ttggctacgt aacgacaatg ggcgaattac      5220
     ttaacgcctc gattatgttc tttgcgccac tgatcattaa tcgcatcggt gggaaaaacg      5280
     ccctgctgct ggctggcact attatgtctg tacgtattat tggctcatcg ttcgccacct      5340
     cagcgctgga agtggttatt ctgaaaacgc tgcatatgtt tgaagtaccg ttcctgctgg      5400
     tgggctgctt taaatatatt accagccagt ttgaagtgcg tttttcagcg acgatttatc      5460
     tggtctgttt ctgcttcttt aagcaactgg cgatgatttt tatgtctgta ctggcgggca      5520
     atatgtatga aagcatcggt ttccagggcg cttatctggt gctgggtctg gtggcgctgg      5580
     gcttcacctt aatttccgtg ttcacgctta gcggccccgg cccgctttcc ctgctgcgtc      5640
     gtcaggtgaa tgaagtcgct taagcaatca atgtcggatg cggcgcgacg cttatccgac      5700
     caacatatca taacggagtg atcgcattga acatgccaat gaccgaaaga ataagagcag      5760
     gcaagctatt taccgatatg tgcgaaggct taccggaaaa aagacttcgt gggaaaacgt      5820
     taatgtatga gtttaatcac tcgcatccat cagaagttga aaaaagagaa agcctgatta      5880
     aagaaatgtt tgccacggta ggggaaaacg cctgggtaga accgcctgtc tatttctctt      5940
     acggttccaa catccatata ggccgcaatt tttatgcaaa tttcaattta accattgtcg      6000
     atgactacac ggtaacaatc ggtgataacg tactgattgc acccaacgtt actctttccg      6060
     ttacgggaca ccctgtacac catgaattga gaaaaaacgg cgagatgtac tcttttccga      6120
     taacgattgg caataacgtc tggatcggaa gtcatgtggt tattaatcca ggcgtcacca      6180
     tcggggataa ttctgttatt ggcgcgggta gtatcgtcac aaaagacatt ccaccaaacg      6240
     tcgtggcggc tggcgttcct tgtcgggtta ttcgcgaaat aaacgaccgg gataagcact      6300
     attatttcaa agattataaa gttgaatcgt cagtttaaat tataaaaatt gcctgatacg      6360
     ctgcgcttat caggcctaca agttcagcga tctacattag ccgcatccgg catgaacaaa      6420
     gcgcaggaac aagcgtcgca tcatgcctct ttgacccaca gctgcggaaa acgtactggt      6480
     gcaaaacgca gggttatgat catcagccca acgacgcaca gcgcatgaaa tgcccagtcc      6540
     atcaggtaat tgccgctgat actacgcagc acgccagaaa accacggggc aagcccggcg      6600
     atgataaaac cgattccctg cataaacgcc accagcttgc cagcaatagc cggttgcaca      6660
     gagtgatcga gcgccagcag caaacagagc ggaaacgcgc cgcccagacc taacccacac      6720
     accatcgccc acaataccgg caattgcatc ggcagccaga taaagccgca gaaccccacc      6780
     agttgtaaca ccagcgccag cattaacagt ttgcgccgat cctgatggcg agccatagca      6840
     ggcatcagca aagctcctgc ggcttgccca agcgtcatca atgccagtaa ggaaccgctg      6900
     tactgcgcgc tggcaccaat ctcaatatag aaagcgggta accaggcaat caggctggcg      6960
     taaccgccgt taatcagacc gaagtaaaca cccagcgtcc acgcgcgggg agtgaatacc      7020
     acgcgaaccg gagtggttgt tgtcttgtgg gaagaggcga cctcgcgggc gctttgccac      7080
     caccaggcaa agagcgcaac aacggcaggc agcgccacca ggcgagtgtt tgataccagg      7140
     tttcgctatg ttgaactaac cagggcgtta tggcggcacc aagcccaccg ccgcccatca      7200
     gagccgcgga ccacagcccc atcaccagtg gcgtgcgctg ctgaaaccgc cgtttaatca      7260
     ccgaagcatc accgcctgaa tgatgccgat ccccacccca ccaagcagtg cgctgctaag      7320
     cagcagcgca ctttgcgggt aaagctcacg catcaatgca ccgacggcaa tcagcaacag      7380
     actgatggcg acactgcgac gttcgctgac atgctgatga agccagcttc cggccagcgc      7440
     cagcccgccc atggtaacca ccggcagagc ggtcgac                               7477
//

You can specifiy a file of ranges to display in uppercase by giving the '-uppercase' qualifier the value '@' followed by the name of the file containing the ranges. (eg: '-upper @myfile').

The format of the range file is:

An example range file is:


# this is my set of ranges
12   23
 4   5       this is like 12-23, but smaller
67   10348   interesting region

You can specifiy a file of ranges to highlight in a different colour when outputting in HTML format (using the '-html' qualifier) by giving the '-highlight' qualifier the value '@' followed by the name of the file containing the ranges. (eg: '-highlight @myfile').

The format of this file is very similar to the format of the above uppercase range file, except that the text after the start and end positions is used as the HTML colour name. This colour name is used 'as is' when specifying the colour in HTML in a '<FONT COLOR=xxx>' construct, (where 'xxx' is the name of the colour).

The standard names of HTML font colours are given in:
http://http://www.w3.org/TR/REC-html40/types.html and http://www.ausmall.com.au/freegraf/ncolour2.htm and http://mindprod.com/htmlcolours.html (amongst other places).

An example highlight range file is:


# this is my set of ranges
12   23		red
 4   5		darkturquoise
67   10348	#FFE4E1

Output file format

Output files for usage example

File: eclac.remap

ECLAC
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.

                                                        Bsu6I
                 TaqI                 AciI              BssKI 
                 \                    \                 \
          GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGT
                   10        20        30        40        50        60        
          ----:----|----:----|----:----|----:----|----:----|----:----|
          CTGTGGTAGCTTACCGCGTTTTGGAAAGCGCCATACCGTACTATCGCGGGCCTTCTCTCA
                   /                    /                  / /
                   TaqI                 AciI               | BssKI
                                                           Bsu6I


# Enzymes that cut  Frequency	Isoschizomers
      AciI	    1	
     BssKI	    1	
     Bsu6I	    1	
      TaqI	    1	



# Enzymes < MINCUTS Frequency	Isoschizomers



# Enzymes > MAXCUTS Frequency	Isoschizomers



# Enzymes that do not cut




# Number of enzymes not matching SITELEN, BLUNT, STICKY, COMMERCIAL criteria

0

Output files for usage example 2

File: eclac.remap

ECLAC
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.

                                                      Hin6I
                 TaqI                                 | HhaI
                 |  Bsc4I                             | Bsu6I
                 |  |   Hin6I                         | BssKI 
                 |  |   | HhaI        AciI            | | BsiSI
                 \  \   \ \           \               \ \ \
          GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGT
                   10        20        30        40        50        60        
          ----:----|----:----|----:----|----:----|----:----|----:----|
          CTGTGGTAGCTTACCGCGTTTTGGAAAGCGCCATACCGTACTATCGCGGGCCTTCTCTCA
                 / /    / /             /             / /  ///
                 | TaqI | Hin6I         AciI          | |  ||BssKI
                 Bsc4I  HhaI                          | |  |BsiSI
                                                      | |  Bsu6I
                                                      | Hin6I
                                                      HhaI


# Enzymes that cut  Frequency	Isoschizomers
      AciI	    1	
     Bsc4I	    1	
     BsiSI	    1	
     BssKI	    1	
     Bsu6I	    1	
      HhaI	    2	
     Hin6I	    2	HinP1I,HspAI
      TaqI	    1	



# Enzymes < MINCUTS Frequency	Isoschizomers



# Enzymes > MAXCUTS Frequency	Isoschizomers



# Enzymes that do not cut

AclI      BamHI     BceAI     Bse1I     BshI      ClaI      EcoRI     EcoRII    
Hin4I     HindII    HindIII   HpyCH4IV  KpnI      NotI      


# Number of enzymes not matching SITELEN, BLUNT, STICKY, COMMERCIAL criteria

0

Output files for usage example 3

File: eclac.remap

ECLAC
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.

                                                                  Bsu6I
                                                        >.........====
                                                          BsiSI
                                                          >===
                        HhaI                             BssKI
                        ==>=                            >=====
                 TaqI   Hin6I                         HhaI
                 >===   >===                          ==>=
              Bsc4I                      AciI         Hin6I
              ======>====             >..====         >===
          GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGT
                   10        20        30        40        50        60        
          ----:----|----:----|----:----|----:----|----:----|----:----|
          CTGTGGTAGCTTACCGCGTTTTGGAAAGCGCCATACCGTACTATCGCGGGCCTTCTCTCA
              ====<======                <===         ===<
              Bsc4I                      AciI         Hin6I
                 ===<   ===<                          =<==  <.....====
                 TaqI   Hin6I                         HhaI        Bsu6I
                        =<==                             =====<
                        HhaI                             BssKI
                                                          ===<
                                                          BsiSI


# Enzymes that cut  Frequency	Isoschizomers
      AciI	    1	
     Bsc4I	    1	
     BsiSI	    1	
     BssKI	    1	
     Bsu6I	    1	
      HhaI	    2	
     Hin6I	    2	HinP1I,HspAI
      TaqI	    1	



# Enzymes < MINCUTS Frequency	Isoschizomers



# Enzymes > MAXCUTS Frequency	Isoschizomers



# Enzymes that do not cut

AclI      BamHI     BceAI     Bse1I     BshI      ClaI      EcoRI     EcoRII    
Hin4I     HindII    HindIII   HpyCH4IV  KpnI      NotI      


# Number of enzymes not matching SITELEN, BLUNT, STICKY, COMMERCIAL criteria

0

The name of the sequence is displayed, followed by the description of the sequence.

The formatted display of cut sites on the sequence follows, with the six-frame translation below it. The cut sites are indicated by a slash character '\' that points to the poition between the nucleotides where the cuts occur. Cuts by many enzymes at the same position are indicated by stacking the enzyme names on top of each other.

At the end the section header 'Enzymes that cut' is displayed followed by a list of the enzymes that cut the specified sequence and the number of times that they cut. For each enzyme that cuts, a list of isoschizomers of that enzyme (sharing the same recognition site pattern and cut sites) is given.

This is followed by lists of the enzymes that do cut, but which cut less often than the '-mincut' qualifier or more often than the '-maxcut' qualifier.

Any of the isoschizomers that are excluded from cutting, (either through restrictions such as the permitted number of cuts, blunt cutters only, single cutters only etc. or because their name has not been given in the input list of enzymes), will not be listed.

Then a list is displayed of the enzymes whose names were input and which match the other criteria ('-sitelen', '-blunt', '-sticky' or '-commercial') but which do not cut.

Finally the number of enzymes that were rejected from consideration because they do not match the '-sitelen', '-blunt', '-sticky' or '-commercial' criteria is displayed.

The '-flatreformat' qualifier changes the display to emphasise the recognition site of the restriction enzyme, which is indicated by a row of '=' characters. The cut site if pointed to by a '>' or '<' character and if the cut site is not within or imemdiately adjacent to the recognition site, they are linked by a row or '.' characters.

The name of the enzyme is displayed above (or below when the reverse sense site if displayed) the recognition site. The name of the enzyme is also displayed above the cut site if this occurs on a different display line to the recognition site (i.e. if it wraps onto the next line of sequence).

Data files

This uses the EMBOSS REBASE data files in 'data/REBASE/*' under the EMBOSS installation directory.

These files must first be set up using the program 'rebaseextract'. Running 'rebaseextract' may be the job of your system manager.

Notes

None.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program nameDescription
abiviewReads ABI file and display the trace
backtranseqBack translate a protein sequence
cirdnaDraws circular maps of DNA constructs
coderetExtract CDS, mRNA and translations from feature tables
lindnaDraws linear maps of DNA constructs
pepnetDisplays proteins as a helical net
pepwheelShows protein sequences as helices
plotorfPlot potential open reading frames
prettyplotDisplays aligned sequences, with colouring and boxing
prettyseqOutput sequence with translated ranges
recoderRemove restriction sites but maintain the same translation
redataSearch REBASE for enzyme name, references, suppliers etc
restoverFinds restriction enzymes that produce a specific overhang
restrictFinds restriction enzyme cleavage sites
seealsoFinds programs sharing group names
showalignDisplays a multiple sequence alignment
showdbDisplays information on the currently available databases
showfeatShow features of a sequence
showorfPretty output of DNA translations
showseqDisplay a sequence with features, translation etc
silentSilent mutation restriction enzyme scan
sixpackDisplay a DNA sequence with 6-frame translation and ORFs
textsearchSearch sequence documentation text. SRS and Entrez are faster!
transeqTranslate nucleic acid sequences

Author(s)

This application was written by Gary Williams (gwilliam@hgmp.mrc.ac.uk)

History

Written Spring 2000

Changed 7 Dec 2000 - GWW - to declare isoschizomers that cut

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments